NOTICE: You are viewing a page of the openwetware wiki. Our "dewikify" feature makes a wiki page appear as a normal web page. In April 2017, this feature will GO AWAY and this URL will redirect to the source URL on our wiki. We're sorry for the inconvenience.
Click here to visit our NEW WEBSITE
The content below is most likely out of date. We also have a new lean and mean openwetware area.




Gene Target Forward Primer Name Forward sequence Reverse Primer Name Reverse sequence product size purpose remarks
GFP GFP-T7-Forward TAATACGACTCACTATAGGG CAAGACACGTGCTGAAGTCAA GFP-T7-Reverse TAATACGACTCACTATAGGG GCCTGAATTTAACCAGGAACC ~450bp w/ T7 overhang, for RNAi Smeister
LacZ LacZ-T7-Forward TAATACGACTCACTATAGGG AGAATCCGACGGGTTGTTACT LacZ-T7-Reverse TAATACGACTCACTATAGGG CACCACGCTCATCGATAATTT ~550bp w/ T7 overhang, for RNAi Smeister
ribosomal S7 S7-A GGCGATCATCATCTACGTGC S7-B GTAGCTGCTGCAAACTTCGG 460bp semiquantitative RT-PCR Smeister
ribosomal S7 AgS7 qRT-PCR F GTGCGCGAGTTGGAGAAGA AgS7 qRT-PCR R ATCGGTTTGGGCAGAATGC 78bp quantitative RT-PCR Smeister
M13/pUC-Forward CGCCAGGGTTTTCCCAGTCACGAC M13/pUC-Reverse AGCGGATAACAATTTCACACAGGA plasmid sequencing Stephan
SP6 Promoter CATACGATTTAGGTGACACTATAG plasmid sequencing Smeister
T7 Promoter 20mer TAATACGACTCACTATAGGG T3 Promoter 23mer GCAATTAACCCTCACTAAAGGGA plasmid sequencing Smeister
T7-d(T)24 GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG(T)24 microarray Smeister